Context:

• The primary intended purpose for enactment of “The DNA Technology (Use and Application) Regulation Bill” is for expanding the application of DNA-based forensic technologies to support and strengthen the justice delivery system of the country.
• The utility of DNA based technologies for solving crimes, and to identify missing persons, is well recognized across the world.

Background

Law Commission report

• In 2017, the Law Commission of India, in its 271st report, prepared the draft Bill named The DNA Based Technology (Use and Regulation) Bill, 2017 after examining various judicial pronouncements and constitutional provisions.
• The exercise was initiated by the Commission after the Department of Biotechnology forwarded its draft of ‘The Use and Regulation of DNA based Technology in Civil and Criminal Proceedings, Identification of Missing Persons and Human Remains Bill, 2016’.

DNA Profiling (DNA fingerprinting, DNA testing, or DNA typing)

• DNA profiling is the process where a specific DNA pattern, called a profile, is obtained from a person or sample of bodily tissue.
• Even though we are all unique, most of our DNA is actually identical to other people’s DNA.
• However, specific regions vary highly between people. These regions are called polymorphic.
• Differences in these variable regions between people are known as polymorphisms.
• Each of us inherits a unique combination of polymorphisms from our parents.
• DNA polymorphisms can be analysed to give a DNA profile.

Short tandem repeats method for DNA Profiling

• One of the current techniques for DNA profiling uses polymorphisms called short tandem repeats.
• Short tandem repeats (or STRs) are regions of non-coding DNA that contain repeats of the same nucleotide sequence.
• For example, GATAGATAGATAGATAGATAGATA is an STR where the nucleotide sequence GATA is repeated six times.
• STRs are found at different places or genetic loci in a person’s DNA.
• To produce a DNA profile, scientists examine STRs at ten, or more, genetic loci. These genetic loci are usually on different chromosomes.

Application of DNA Profiling

• Identify the probable origin of a body fluid sample associated with a crime or crime scene
• Reveal family relationships
• Identify disaster victims

Source:PIB